ELLS

European Learning Laboratory for the Life Sciences

Our inspiring educational experiences share the scientific discoveries of EMBL with young learners aged 10-19 years and teachers in Europe and beyond.

This article is also available in  English,  Français,  Ελληνικά,  Italiano and  Svenska

Honba za pokladem – GFP – úvod

Úvod

Jak vypadá biologická sekvence a co všechno se s ní dá dělat?

Představte si, že vaše sekvenační centrum osekvenovalo DNA vzorky několika fluorescenčních proteinů. Předtím, než začnete analyzovat sekvenační výsledky, podívejte se jak vlastně takové výsledky vypadají.

Výsledky sekvenace DNA se dají zobrazit dvěma hlavními způsoby:

1. Sekvenační chromatogramy

Sekvenační chromatogram ukazuje přímo výstup ze sekvenačního přístroje v podobě vrcholů (tzv. “peaků”).
Každá báze má jinou barvu:
A = zelená , C = modrá,G = černá, T = červená

DNA sekvence se tak dá číst jako sekvence jednotlivých “peaků”. Zde je příklad takového sekvenačního chromatogramu:

2. Textové soubory ve formátu FASTA

FASTA formát je obecný textový formát k ukládání a zobrazování nukleotidových (DNA a RNA) i proteinových sekvencí. Tento formát vždy obsahuje řádek se znaménkem “větší než” – “>”, následovaným názvem či krátkým popisem sekvence. Název sekvence následuje za znaménkem “>” bez jakékoliv mezery. Další řádek obsahuje samotnou sekvenci. Zde je příklad nukleotidové sekvence ve formátu FASTA:

>Human_1233_P1
AGGAGCAGGGAGGGCAGGAGCCAGGGCTGGGCATAAAAGTCAGGGCAGAGCCATCTATTGCTTACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGGAAGTTGGTGGTGAGGCCCTGGGCAGGTTGGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCATGTGGAGACAGAGAAGACTCTTGGGTTTCTGATAGGCACTGACTCTCTCTGCCTATTGGTCTATTTTCCCACCCTTAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGGT


Pro sekvence ve formátu FASTA se pro jednotlivé báze či aminokyseliny používají jednopísmenné kódy:

1-písmenné kódy pro nukleové kyseliny:
Adenine = A
Cytosine = C
Guanine = G
Thymine = T

1-písmenné kódy pro aminokyseliny:
Alanine A, Arginine R, Asparagine N, Aspartate D, Cysteine C, Glutamine Q, Glutamic acid E, Glycine G, Histidine H, Isoleucine I, Leucine L, Lysine K, Methionine M, Phenylalanine F, Proline P, Serine S, Threonine T, Tryptophane W, Tyrosine Y, Valine V

Navigace aktivity

Honba za pokladem – GFP

Share: