ELLS

European Learning Laboratory for the Life Sciences

Our inspiring educational experiences share the scientific discoveries of EMBL with young learners aged 10-19 years and teachers in Europe and beyond.

This article is also available in  English,  Čeština,  Français,  Ελληνικά and  Svenska

Caccia al tesoro GFP – Introduzione

Introduzione

Come appare una sequenza biologica e cosa ci possiamo fare?

Immaginate che la the EMBL Genomics Core Facility abbia sequenziato campioni di DNA di differenti proteine fluorescenti. Prima di iniziare la vostra analisi bioinformatica su questi campioni, leggete qui sotto per capire che aspetto hanno i risultati del sequenziamento del DNA.

I risultati del sequenziamento del DNA possono essere visualizzati in due modi :

1. Cromatogrammi di sequenziamento

Un cromatogramma di sequenziamento mostra i dati prodotti dalla macchina sequenziatrice sotto forma dei cosiddetti “picchi”. A ciascuna delle 4 basi azotate è assegnato un diverso colore :
A = verde , C = blu , G = nero, T = rosso

la sequenza del DNA può essere “letta” come sequenza dei singoli picchi. L’esempio seguente illustra uno di questi cromatogrammi di sequenziamento:

2. File di testo in formato FASTA

Il formato FASTA è un formato di testo utilizzato per mostrare e archiviare sequenze di acidi nucleici (DNA e RNA) e di aminoacidi (proteine).
Ogni sequenza inizia con una riga contenente il segno maggiore (>) ed un’intestazione descrittiva (che è il nome della sequenza). Il nome della sequenza é aggiunto dopo il segno > senza spazio. Le righe seguenti contengono la sequenza. Qui sotto è riportato un esempio di una sequenza in formato FASTA :

>Human_1233_P1
AGGAGCAGGGAGGGCAGGAGCCAGGGCTGGGCATAAAAGTCAGGGCAGAGCCATCTATTGCTTACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGGAAGTTGGTGGTGAGGCCCTGGGCAGGTTGGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCATGTGGAGACAGAGAAGACTCTTGGGTTTCTGATAGGCACTGACTCTCTCTGCCTATTGGTCTATTTTCCCACCCTTAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGGT

Nelle sequenza in formato FASTA codici di 1 lettera sono utilizzati per gli acidi nucleici e per gli aminoacidi:

Codici di 1 lettera per gli acidi nucleici:
Adenina = A
Citosina = C
Guanina = G
Timina = T

codici di 1 lettera per gli aminoacidi:
Alanina A, Arginina R, Asparagina N, Aspartato D, Cisteina C, Glutamina Q, Acido glutamico E, Glicina G, Istidina H, Isoleucina I, Leucina L, Lisina K, Metionina M, Fenilalanina F, Prolina P, Serina S, Treonina T, Triptofano W, Tirosina Y, Valina V

Navigazione attività

Caccia al tesoro GFP

Share: