ELLS

European Learning Laboratory for the Life Sciences

Our inspiring educational experiences share the scientific discoveries of EMBL with young learners aged 10-19 years and teachers in Europe and beyond.

This article is also available in  English,  Čeština,  Français,  Italiano and  Svenska

Εισαγωγή στο κυνήγι θησαυρού της πράσινης φθορίζουσας πρωτεΐνης – GFP

Εισαγωγή

Πως μοιάζει μια αλληλουχία ενός βιολογικού μορίου και τι μπορεί κανείς να κάνει με αυτή;

Φαντάσου ότι έχεις στη διάθεσή σου δείγματα DNA των οποίων η αλληλουχία έχει αναλυθεί από τις ειδικές εγκαταστάσεις Γονιδιωματικής Ανάλυσης του Ευρωπαϊκού Εργαστηρίου Μοριακής Βιολογίας (EMBL) και οι οποίες κωδικοποιούν διαφορετικούς τύπους φθορίζουσας πρωτεΐνης. Πριν ξεκινήσεις την ανάλυσή σου σε αυτά τα δείγματα με τη χρήση εργαλείων Βιοπληροφορικής, διάβασε το παρακάτω κείμενο ώστε να κατανοήσεις πως μοιάζουν τα αποτελέσματα που επιστρέφει μια συσκευή αλληλούχησης DNA.

Τα αποτελέσματα από την αλληλούχηση μορίων DNA μπορούν να έχουν τις παρακάτω δύο μορφές:

1. Χρωματογραφήματα αλληλουχιών

Ένα χρωματογράφημα αλληλουχίας απεικονίζει τα δεδομένα που παράχθηκαν από μια συσκευή αλληλούχησης του DNA με τη μορφή “κορυφών”.
Για κάθε αζωτούχα βάση του DNA χρησιμοποιείται διαφορετικό χρώμα και συγκεκριμένα:


A = πράσινο , C = μπλε , G = μαύρο, T = κόκκινο

Η αλληλουχία του DNA μπορεί να “διαβαστεί” σαν μια σειρά από διακριτές κορυφές. Παρακάτω παρατίθεται ένα παράδειγμα χρωματογραφήματος αλληλουχίας.

2. Αρχεία κειμένου σε μορφή FASTA

Τα αρχεία FASTA είναι ουσιαστικά αρχεία κειμένου που περιέχουν αλληλουχίες νουκλεϊκών οξέων (DNA και RNA) καθώς και αμινοξέων (πρωτεΐνες). Κάθε αλληλουχία ξεκινάει με μια γραμμή που περιέχει ένα σύμβολο ανισότητας(>) και έναν τίτλο (που είναι το όνομα της αλληλουχίας). Το όνομα της αλληλουχίας τοποθετείται αμέσως μετά το σύμβολο (>) χωρίς κενό. Οι επόμενες γραμμές περιέχουν δεδομένα μιας αλληλουχίας.
Παρακάτω δίνεται ένα παράδειγμα αλληλουχίας σε μορφή FASTA:

>Human_1233_P1
AGGAGCAGGGAGGGCAGGAGCCAGGGCTGGGCATAAAAGTCAGGGCAGAGCCATCTATTGCTTACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGGAAGTTGGTGGTGAGGCCCTGGGCAGGTTGGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCATGTGGAGACAGAGAAGACTCTTGGGTTTCTGATAGGCACTGACTCTCTCTGCCTATTGGTCTATTTTCCCACCCTTAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGGT

Μέσα σε μια αλληλουχία FASTΑ χρησιμοποιούνται ειδικά σύμβολα για τα νουκλεϊκά οξέα και τα αμινοξέα:


Ειδικά σύμβολα για τα νουκλεϊκά οξέα:
Αδενίνη = A
Κυτοσίνη = C
Γουανίνη = G
Θυμίνη = T


Ειδικά σύμβολα για τα αμινοξέα:
Αλανίνη A, Αργινίνη R, Ασπαραγίνη N, Ασπαρτικό οξύ D, Κυστεΐνη C, Γλουταμίνη Q, Γλουταμινικό οξύ E, Γλυκίνη G, Ιστιδίνη H, Ισολευκίνη I, Λευκίνη L, Λυσίνη K, Μεθειονίνη M, Φαινυλαλανίνη F, Προλίνη P, Σερίνη S, Θρεονίνη T, Τρυπτοφάνη W, Τυροσίνη Y, Βαλίνη V

Πλοήγηση δραστηριότητας

Κυνήγι θησαυρού της πράσινης φθορίζουσας πρωτεΐνης – GFP

Share: