ELLS

European Learning Laboratory for the Life Sciences

Our inspiring educational experiences share the scientific discoveries of EMBL with young learners aged 10-19 years and teachers in Europe and beyond.

This article is also available in  English,  Čeština,  Français,  Ελληνικά and  Italiano

GFP skattjakt introduktion

Introduktion

Hur ser en biologisk sekvens ut och vad kan du göra med den?

Föreställ dig att EMBL Genomics Core Facility har sekvenserat DNA-prover med olika fluorescerande proteiner. Innan du startar bioinformatik-analysen utifrån dessa prover, läs nedanstående för att förstå hur resultat från DNA-sekvensering presenteras.

Resultat från DNA-sekvensering kan visualiseras på två olika sätt:

1.Sekvenserings-kromatogram

Ett sekvenserings-kromatogram visar data som producerats av sekvenseringsmaskinen som så kallade “peaks”. Olika färger används för var och en av de 4 baserna:
A = grön , C = blå , G = svart, T = röd

DNA-sekvensen kan “läsas” som en sekvens med enskilda “peaks”. Följande är ett exempel på ett sådant sekvenserings-kromatogram:

2. Text filer i FASTA format

FASTA format är ett textbaserat format som används för att visa och lagra nukleinsyrasekvenser (DNA and RNA) och aminosyrasekvenser (protein).Varje sekvens startar med en rad med ett större-än-tecken (>) och en beskrivande rubrik (det här är namnet på sekvensen). Namnet på sekvensen läggs till utan att använda mellanslagstangenten. Därefter följer rader med sekvensdata. Följande visar ett exempel på en sekvens i FASTA format:

>Human_1233_P1
AGGAGCAGGGAGGGCAGGAGCCAGGGCTGGGCATAAAAGTCAGGGCAGAGCCATCTATTGCTTACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGGAAGTTGGTGGTGAGGCCCTGGGCAGGTTGGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCATGTGGAGACAGAGAAGACTCTTGGGTTTCTGATAGGCACTGACTCTCTCTGCCTATTGGTCTATTTTCCCACCCTTAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGGT

Inom FASTA sekvenser används 1-bokstavskoder för nukleinsyror and aminosyror:

1-bokstavskoder för nukleinsyror :
Adenin = A
Cytosin = C
Guanin = G
Tymin = T

1-bokstavskoder för aminosyror:
Alanin A, Arginin R, Asparagin N, Asparaginsyra D, Cystein C, Glutamin Q, Glutaminsyra E, Glycin G, Histidin H, Isoleucin I, Leucin L, Lysin K, Metionin M, Fenylalanin F, Prolin P, Serin S, Treonin T, Tryptofan W, Tyrosin Y, Valin V

Aktivitetsnavigering

GFP skattjakt

Share: