ELLS

European Learning Laboratory for the Life Sciences

Our inspiring educational experiences share the scientific discoveries of EMBL with young learners aged 10-19 years and teachers in Europe and beyond.

This article is also available in  English,  Français,  Ελληνικά,  Italiano and  Svenska

Krok 2: Porovnání nukleotidových sekvencí

Úvod

K porovnání všech nukleotidových sekvencí najednou použijeme online nástroj EBI MUSCLE (European Bioinformatics Institute Multiple Sequence Comparison by Log-Expectation). MUSCLE vytváří tzv. sekvenční přiřazení (sequence alignments). Tato přiřazení se následně dají použít k vizualizaci a interpretaci vztahů mezi sekvencemi, a někdy dokonce k rozluštění vztahů mezi biologickými druhy.Po skončení tohoto cvičení byste měli mít vytvořeno mnohočetné přiřazení nukleotidových sekvencí a můžete tak zjistit, které ze sekvencí jsou si nejpodobnější. Nukleotidové sekvence najdete v záložce “Sekvence”

Vaše úloha

Postupujte následovně:

  1. Zkopírujte všechny nukleotidové sekvence ze záložky “Sekvence”  (tj. vyberte a kopírujte celý blok sekvencí, např. pomocí Ctrl+C).
  2. Vložte sekvence do vstupního pole programu MUSCLE. (pomocí Ctrl + V).
  3. Řiďte se instrukcemi v záložce MUSCLE.
  4. Prohlédněte si výsledek přiřazení a pokuste se odpovědět na otázky v záložce “Otázky”.

MUSCLE

  1. Zkopírujte všechny nukleotidové sekvence ze záložky “Sekvence”  (tj. vyberte a kopírujte celý blok sekvencí, např. pomocí Ctrl+C).
  2. Vložte sekvence do vstupního pole programu MUSCLE. (pomocí Ctrl + V).
  3. V druhém kroku (“STEP 2”) nastavte “Output Format” na “ClustalW”.
  4. Klikněte na tlačítko “Submit“, čímž odešlete vaše sekvence serveru ke zpracování.
  5. Za několik sekund obdržíte výsledek. Pokuste se odpovědět na otázky v záložce “Otázky”.

Sekvence 1-4

Sekvence 1
>Sequence1_AVGFP
ATGAGTAAAGGAGAAGAACTTTTCACTGGAGTGGTCCCAGTTCTTGTTGAATTAGATGGCGATGTTAATGGGCAAAAATTCTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAATTTTATTTGCACTACTGGGAAGCTACCTGTTCCATGGCCAACACTTGTCACTACTTTCTCTTATGGTGTTCAATGCTTCTCAAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTACAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAAATGGAATACAACTATAACTCACATAATGTATACATCATGGGAGACAAACCAAAGAATGGCATCAAAGTTAACTTCAAAATTAGACACAACATTAAAGATGGAAGCGTTCAATTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCCAAAGATCCCAACGAAAAGAGAGATCACATGATCCTTCTTGAGTTTGTAACAGCTGCTAGGATTACACATGGCATGGATGAACTATACAAA
Sekvence 2
 >Sequence2_GFPm
ATGTCTAAAGGTGAAGAATTATTCACTGGTGTTGTCCCAATTTTGGTTGAATTAGATGGTGATGTTAATGGTCACAAATTTTCTGTCTCCGGTGAAGGTGAAGGTGATGCTACTTACGGTAAATTGACCTTAAAATTTATTTGTACTACTGGTAAATTGCCAGTTCCATGGCCAACCTTAGTCACTACTTTCGGTTATGGTGTTCAATGTTTTGCTAGATACCCAGATCATATGAAACAACATGACTTTTTCAAGTCTGCCATGCCAGAAGGTTATGTTCAAGAAAGAACTATTTTTTTCAAAGATGACGGTAACTACAAGACCAGAGCTGAAGTCAAGTTTGAAGGTGATACCTTAGTTAATAGAATCGAATTAAAAGGTATTGATTTTAAAGAAGATGGTAACATTTTAGGTCACAAATTGGAATACAACTATAACTCTCACAATGTTTACATCATGGCTGACAAACAAAAGAATGGTATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGTTCTGTTCAATTAGCTGACCATTATCAACAAAATACTCCAATTGGTGATGGTCCAGTCTTGTTACCAGACAACCATTACTTATCCACTCAATCTGCCTTATCCAAAGATCCAAACGAAAAGAGAGACCACATGGTCTTGTTAGAATTTGTTACTGCTGCTGGTATTACCCATGGTATGGATGAATTGTACAAATAACTGCAG
Sekvence 3
>Sequence3_YFP
AATATTTTTATTAATTCATTAGAAAAATGAGAGGAAGGATTATTATGTTTAAAGGTATAGTAGAAGGTATAGGAATCATTGAAAAAATTGATATATATACTGACCTAGATAAGTATGCAATTCGATTTCCTGAAAATATGTTGAATGGAATTAAAAAGGAGTCGTCAATAATGTTTAACGGATGCTTCTTAACGGTAACTAGCGTGAATTCAAACATTGTCTGGTTTGATATATTTGAAAAAGAAGCACGTAAGCTTGATACTTTTCGGGAATATAAGGTAGGTGACCGAGTAAATTTAGGAACATTCCCAAAATTTGGCGCTGCATCTGGTGGGCATATATTATCAGCAAGGATTTCATGTGTAGCAAGTATTATTGAAATAATAGAAAATGAGGATTATCAACAAATGTGGATTCAAATTCCTGAAAATTTTACAGAGTTTCTTATTGATAAAGACTATATTGCTGTGGATGGTATTAGCTTAACTATTGACACTATAAAAAACAACCAATTTTTCATTAGTTTACCCTTAAAAATAGCACAAAATACAAATATGAAATGGCGAAAAAAAGGTGATAAGGTAAATGTTGAGTTATCAAACAAAATTAATGCTAACCAGTGTTGGTAATTTACTGAGGATAGTAAAAATGAACTGTTTAAAATAATATTTAAATTTTTATTTATAATACAGAGTCAGTTGTTGTAAATAGTCTGAGTGGTAAATAAGTTCTACCATTAATTAAATATTATCCATATTAAATAAAGGATCT
Sekvence 4
>Sequence4_RFP
AGTTTCAGCCAGTGACAGGGTGAGCTGCCAGGTATTCTAACAAGATGAGTTGTTCCAAGAATGTGATCAAGGAGTTCATGAGGTTCAAGGTTCGTATGGAAGGAACGGTCAATGGGCACGAGTTTGAAATAAAAGGCGAAGGTGAAGGGAGGCCTTACGAAGGTCACTGTTCCGTAAAGCTTATGGTAACCAAGGGTGGACCTTTGCCATTTGCTTTTGATATTTTGTCACCACAATTTCAGTATGGAAGCAAGGTATATGTCAAACACCCTGCCGACATACCAGACTATAAAAAGCTGTCATTTCCTGAGGGATTTAAATGGGAAAGGGTCATGAACTTTGAAGACGGTGGCGTGGTTACTGTATCCCAAGATTCCAGTTTGAAAGACGGCTGTTTCATCTACGAGGTCAAGTTCATTGGGGTGAACTTTCCTTCTGATGGACCTGTTATGCAGAGGAGGACACGGGGCTGGGAAGCCAGCTCTGAGCGTTTGTATCCTCGTGATGGGGTGCTGAAAGGAGACATCCATATGGCTCTGAGGCTGGAAGGAGGCGGCCATTACCTCGTTGAATTCAAAAGTATTTACATGGTAAAGAAGCCTTCAGTGCAGTTGCCAGGCTACTATTATGTTGACTCCAAACTGGATATGACGAGCCACAACGAAGATTACACAGTCGTTGAGCAGTATGAAAAAACCCAGGGACGCCACCATCCGTTCATTAAGCCTCTGCAGTGAACTCGGCTCAGTCATGGATTAGCGGTAATGGCCACAAAAGGCACGATGATCGTTTTTTAGGAATGCAGCCAAAAATTGAAGGTTATGACAGTAGAAATACAAGCAACAGGCTTTGCTTATTAAACATGTAATTGAAAAC

Otázky

Projděte výsledky přiřazení a pokuste se odpovědět na následující otázky:

  • Jak jednoduše zjistíte, které nukleotidy v jednotlivých sekvencích jsou identické nebo odlišné v porovnání s ostatními sekvencemi?
  • Připadá vám, že je identických nukletidových pozic spíše více, nebo málo? Očekávali jste jiný výsledek?
  • Které ze sekvencí jsou si nejpodobnější?

Navigace aktivity

Honba za pokladem – GFP

Share: