ELLS

European Learning Laboratory for the Life Sciences

Our inspiring educational experiences share the scientific discoveries of EMBL with young learners aged 10-19 years and teachers in Europe and beyond.

This article is also available in  English,  Français,  Ελληνικά,  Italiano and  Svenska

Krok 1: Vyhledávání v databázi

Úvod

Představte si, že vaše vzorky DNA se před odesláním do sekvenačního centra omylem pomíchaly a my teď nevíme, který je který. Abychom znovu určili jejich původní totožnost, prohledáme nukleotidovou databázi zvanou European Nucleotide Archive (ENA).

Sekvence, které chceme analyzovat, naleznete v záložce “Sekvence”. Každá z nich má pouze velmi obecný název, ale po prohledání ENA byste měli být schopni označit sekvence pravým jménem a určit organismus, ze kterého pocházejí.

Vaše úloha

Postupujte následovně:

  1. Jděte do záložky “Sekvence 1” a zkopírujte celou sekvenci včetně identifikátoru “>Sequence 1” (pro zkopírování použijte Ctrl.+C).
  2. Řiďte se pokyny v záložce “ENA”.
  3. Zaznamenejte si, co jste našli a pokuste se odpovědět na otázky v záložce “Otázky”. Stejně postupujte i se zbytkem sekvencí.

ENA

  1. Vložte sekveci do vstupního okna programu ENA (pomocí Ctrl.+V).
  2. Nyní klikněte na “Submit” dole na stránce, čímž zahájíte prohledávání databáze. Vámi vložená sekvence je porovnávána se všemi sekvencemi přitomnými v databázi.
  3. Za několik sekund se objeví výsledky. Projděte stránku výsledků a ve sloupečcích označených “ENA” se pokuste najít, sekvence kterého biologického druhu byla nalezena jako nejpodobnější naší neznámé sekvenci. Nejpodobnější sekvence mají “Identity (%)” rovnou 100 a “E-Value” rovnu 0.
  4. Zaznamenejte si, co jste našli a pokuste se odpovědět na otázky v záložce “Otázky”. Stejně postupujte i se zbytkem sekvencí.

Sekvence 1-4

Sekvence 1
>Sequence1_AVGFP
ATGAGTAAAGGAGAAGAACTTTTCACTGGAGTGGTCCCAGTTCTTGTTGAATTAGATGGCGATGTTAATGGGCAAAAATTCTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAATTTTATTTGCACTACTGGGAAGCTACCTGTTCCATGGCCAACACTTGTCACTACTTTCTCTTATGGTGTTCAATGCTTCTCAAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTACAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAAATGGAATACAACTATAACTCACATAATGTATACATCATGGGAGACAAACCAAAGAATGGCATCAAAGTTAACTTCAAAATTAGACACAACATTAAAGATGGAAGCGTTCAATTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCCAAAGATCCCAACGAAAAGAGAGATCACATGATCCTTCTTGAGTTTGTAACAGCTGCTAGGATTACACATGGCATGGATGAACTATACAAA
Sekvence 2

>Sequence2_GFPm
ATGTCTAAAGGTGAAGAATTATTCACTGGTGTTGTCCCAATTTTGGTTGAATTAGATGGTGATGTTAATGGTCACAAATTTTCTGTCTCCGGTGAAGGTGAAGGTGATGCTACTTACGGTAAATTGACCTTAAAATTTATTTGTACTACTGGTAAATTGCCAGTTCCATGGCCAACCTTAGTCACTACTTTCGGTTATGGTGTTCAATGTTTTGCTAGATACCCAGATCATATGAAACAACATGACTTTTTCAAGTCTGCCATGCCAGAAGGTTATGTTCAAGAAAGAACTATTTTTTTCAAAGATGACGGTAACTACAAGACCAGAGCTGAAGTCAAGTTTGAAGGTGATACCTTAGTTAATAGAATCGAATTAAAAGGTATTGATTTTAAAGAAGATGGTAACATTTTAGGTCACAAATTGGAATACAACTATAACTCTCACAATGTTTACATCATGGCTGACAAACAAAAGAATGGTATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGTTCTGTTCAATTAGCTGACCATTATCAACAAAATACTCCAATTGGTGATGGTCCAGTCTTGTTACCAGACAACCATTACTTATCCACTCAATCTGCCTTATCCAAAGATCCAAACGAAAAGAGAGACCACATGGTCTTGTTAGAATTTGTTACTGCTGCTGGTATTACCCATGGTATGGATGAATTGTACAAATAACTGCAG
Sekvence 3
>Sequence3_YFP
AATATTTTTATTAATTCATTAGAAAAATGAGAGGAAGGATTATTATGTTTAAAGGTATAGTAGAAGGTATAGGAATCATTGAAAAAATTGATATATATACTGACCTAGATAAGTATGCAATTCGATTTCCTGAAAATATGTTGAATGGAATTAAAAAGGAGTCGTCAATAATGTTTAACGGATGCTTCTTAACGGTAACTAGCGTGAATTCAAACATTGTCTGGTTTGATATATTTGAAAAAGAAGCACGTAAGCTTGATACTTTTCGGGAATATAAGGTAGGTGACCGAGTAAATTTAGGAACATTCCCAAAATTTGGCGCTGCATCTGGTGGGCATATATTATCAGCAAGGATTTCATGTGTAGCAAGTATTATTGAAATAATAGAAAATGAGGATTATCAACAAATGTGGATTCAAATTCCTGAAAATTTTACAGAGTTTCTTATTGATAAAGACTATATTGCTGTGGATGGTATTAGCTTAACTATTGACACTATAAAAAACAACCAATTTTTCATTAGTTTACCCTTAAAAATAGCACAAAATACAAATATGAAATGGCGAAAAAAAGGTGATAAGGTAAATGTTGAGTTATCAAACAAAATTAATGCTAACCAGTGTTGGTAATTTACTGAGGATAGTAAAAATGAACTGTTTAAAATAATATTTAAATTTTTATTTATAATACAGAGTCAGTTGTTGTAAATAGTCTGAGTGGTAAATAAGTTCTACCATTAATTAAATATTATCCATATTAAATAAAGGATCT
Sekvence 4
>Sequence4_RFP
AGTTTCAGCCAGTGACAGGGTGAGCTGCCAGGTATTCTAACAAGATGAGTTGTTCCAAGAATGTGATCAAGGAGTTCATGAGGTTCAAGGTTCGTATGGAAGGAACGGTCAATGGGCACGAGTTTGAAATAAAAGGCGAAGGTGAAGGGAGGCCTTACGAAGGTCACTGTTCCGTAAAGCTTATGGTAACCAAGGGTGGACCTTTGCCATTTGCTTTTGATATTTTGTCACCACAATTTCAGTATGGAAGCAAGGTATATGTCAAACACCCTGCCGACATACCAGACTATAAAAAGCTGTCATTTCCTGAGGGATTTAAATGGGAAAGGGTCATGAACTTTGAAGACGGTGGCGTGGTTACTGTATCCCAAGATTCCAGTTTGAAAGACGGCTGTTTCATCTACGAGGTCAAGTTCATTGGGGTGAACTTTCCTTCTGATGGACCTGTTATGCAGAGGAGGACACGGGGCTGGGAAGCCAGCTCTGAGCGTTTGTATCCTCGTGATGGGGTGCTGAAAGGAGACATCCATATGGCTCTGAGGCTGGAAGGAGGCGGCCATTACCTCGTTGAATTCAAAAGTATTTACATGGTAAAGAAGCCTTCAGTGCAGTTGCCAGGCTACTATTATGTTGACTCCAAACTGGATATGACGAGCCACAACGAAGATTACACAGTCGTTGAGCAGTATGAAAAAACCCAGGGACGCCACCATCCGTTCATTAAGCCTCTGCAGTGAACTCGGCTCAGTCATGGATTAGCGGTAATGGCCACAAAAGGCACGATGATCGTTTTTTAGGAATGCAGCCAAAAATTGAAGGTTATGACAGTAGAAATACAAGCAACAGGCTTTGCTTATTAAACATGTAATTGAAAAC

Otázky

  • Které biologické druhy odpovídají sekvencím 1, 2, 3 a 4?
  • Podíváte-li se na výsledky “Alignments”, můžete si zobrazit i vzájemné (1:1) porovnání dvou sekvencí. Toto se nazývá “pairwise alignment” (párové porovnání) a zobrazíte ho tak, že buď kliknete na výsledky jednotlivých porovnání, nebo “Show all alignments” dole na stránce výsledků ENA.
    • Jak jsou označeny nukleotidy, které jsou shodné v obou sekvencích?
    • Porovnejte vaši původní sekvencí se sekvencí z databáze. Najdete mnoho rozdílů?
    • Najdete rozdíly mezi jednotlivými nukleotidy ve dvou porovnaných sekvencích? Napadají vás důvody proč tomu tak je?

Navigace aktivity

Honba za pokladem – GFP

Share: