ELLS

European Learning Laboratory for the Life Sciences

Our inspiring educational experiences share the scientific discoveries of EMBL with young learners aged 10-19 years and teachers in Europe and beyond.

This article is also available in  English,  Čeština,  Français,  Italiano and  Svenska

Βήμα 3: Μετάφραση των mRNAs

ΣΦΑΙΡΙΚΗ ΕΙΚΟΝΑ

Σε αυτό το μέρος της δραστηριότητας, θα μεταφράσουμε τις αλληλουχίες mRNA των τεσσάρων φθοριζουσών πρωτεϊνών σε αλληλουχίες αμινοξέων. Για να το κάνουμε αυτό, θα χρησιμοποιήσουμε ένα εργαλείο Βιοπληροφορικής που ονομάζεται EMBOSS Transeq (European Molecular Biology Open Software Suite Transeq). Αυτό το ελεύθερο διαδικτυακό εργαλείο προσομοιώνει τη μετάφραση των αλληλουχιών mRNA σε αλληλουχίες αμινοξέων χρησιμοποιώντας τα ειδικά σύμβολα για τα αμινοξέα που έχουν αναφερθεί.

Οι αλληλουχίες που θα χρησιμοποιήσουμε για την ανάλυσή μας μπορούν να βρεθούν στο πεδίο “Α” που βρίσκεται πιο κάτω.

Η εργασία σου

Προχώρησε όπως περιγράφεται παρακάτω:

  1. Πήγαινε στο πεδίο “Αλληλουχία 1” και κάνε αντιγραφή ολόκληρης της αλληλουχίας mRNA με το όνομα >Sequence1 (ή χρησιμοποίησε τα πλήκτρα Ctrl.+C για συντομία).
  2. Επικόλλησε τη νουκλεοτιδική αλληλουχία στο πεδίο αναζήτησης του εργαλείου EMBOSS Transeq (ή χρησιμοποίησε τα πλήκτρα Ctrl.+C για συντομία).
  3. Ακολούθησε τις οδηγίες στο πεδίο του λογισμικού “EMBOSS Transeq” για να μεταφράσεις την αλληλουχία.
  4. Δες την πρωτεΐνη που προέκυψε από τη μετάφραση και προσπάθησε να απαντήσεις τις ερωτήσεις στο αντίστοιχο πεδίο.
  5. Επανάλαβε την ίδια διαδικασία και για τις 4 αλληλουχίες.

Εργαλείο EMBOSS Transeq

  1. Πήγαινε στο πεδίο “Αλληλουχία 1” και κάνε αντιγραφή ολόκληρης της αλληλουχίας mRNA με το όνομα >Sequence1 (ή χρησιμοποίησε τα πλήκτρα Ctrl.+C για συντομία).
  2. Επικόλλησε τη νουκλεοτιδική αλληλουχία στο πεδίο αναζήτησης του εργαλείου EMBOSS Transeq (ή χρησιμοποίησε τα πλήκτρα Ctrl.+C για συντομία).
  3. Άφησε όλες τις άλλες ρυθμίσεις όπως έχουν.
  4. Κάνε κλικ στο μεγάλο κουμπί “Submit” και η αλληλουχία σου θα μεταφραστεί.
  5. Θα μπορείς να δεις τα αποτελέσματά σου μετά από μερικά δευτερόλεπτα.
  6. Δες την πρωτεΐνη που προέκυψε και προσπάθησε να απαντήσεις τις ερωτήσεις στο αντίστοιχο πεδίο.
  7. Επανέλαβε την ίδια διαδικασία και για τις 4 αλληλουχίες.

Ακολουθίες 1-4

A 1
>Sequence1_AVGFP
ATGAGTAAAGGAGAAGAACTTTTCACTGGAGTGGTCCCAGTTCTTGTTGAATTAGATGGCGATGTTAATGGGCAAAAATTCTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAATTTTATTTGCACTACTGGGAAGCTACCTGTTCCATGGCCAACACTTGTCACTACTTTCTCTTATGGTGTTCAATGCTTCTCAAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTACAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAAATGGAATACAACTATAACTCACATAATGTATACATCATGGGAGACAAACCAAAGAATGGCATCAAAGTTAACTTCAAAATTAGACACAACATTAAAGATGGAAGCGTTCAATTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCCAAAGATCCCAACGAAAAGAGAGATCACATGATCCTTCTTGAGTTTGTAACAGCTGCTAGGATTACACATGGCATGGATGAACTATACAAA
A 2
>Sequence2_GFPm
ATGTCTAAAGGTGAAGAATTATTCACTGGTGTTGTCCCAATTTTGGTTGAATTAGATGGTGATGTTAATGGTCACAAATTTTCTGTCTCCGGTGAAGGTGAAGGTGATGCTACTTACGGTAAATTGACCTTAAAATTTATTTGTACTACTGGTAAATTGCCAGTTCCATGGCCAACCTTAGTCACTACTTTCGGTTATGGTGTTCAATGTTTTGCTAGATACCCAGATCATATGAAACAACATGACTTTTTCAAGTCTGCCATGCCAGAAGGTTATGTTCAAGAAAGAACTATTTTTTTCAAAGATGACGGTAACTACAAGACCAGAGCTGAAGTCAAGTTTGAAGGTGATACCTTAGTTAATAGAATCGAATTAAAAGGTATTGATTTTAAAGAAGATGGTAACATTTTAGGTCACAAATTGGAATACAACTATAACTCTCACAATGTTTACATCATGGCTGACAAACAAAAGAATGGTATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGTTCTGTTCAATTAGCTGACCATTATCAACAAAATACTCCAATTGGTGATGGTCCAGTCTTGTTACCAGACAACCATTACTTATCCACTCAATCTGCCTTATCCAAAGATCCAAACGAAAAGAGAGACCACATGGTCTTGTTAGAATTTGTTACTGCTGCTGGTATTACCCATGGTATGGATGAATTGTACAAATAACTGCAG
A 3
>Sequence3_YFP
AATATTTTTATTAATTCATTAGAAAAATGAGAGGAAGGATTATTATGTTTAAAGGTATAGTAGAAGGTATAGGAATCATTGAAAAAATTGATATATATACTGACCTAGATAAGTATGCAATTCGATTTCCTGAAAATATGTTGAATGGAATTAAAAAGGAGTCGTCAATAATGTTTAACGGATGCTTCTTAACGGTAACTAGCGTGAATTCAAACATTGTCTGGTTTGATATATTTGAAAAAGAAGCACGTAAGCTTGATACTTTTCGGGAATATAAGGTAGGTGACCGAGTAAATTTAGGAACATTCCCAAAATTTGGCGCTGCATCTGGTGGGCATATATTATCAGCAAGGATTTCATGTGTAGCAAGTATTATTGAAATAATAGAAAATGAGGATTATCAACAAATGTGGATTCAAATTCCTGAAAATTTTACAGAGTTTCTTATTGATAAAGACTATATTGCTGTGGATGGTATTAGCTTAACTATTGACACTATAAAAAACAACCAATTTTTCATTAGTTTACCCTTAAAAATAGCACAAAATACAAATATGAAATGGCGAAAAAAAGGTGATAAGGTAAATGTTGAGTTATCAAACAAAATTAATGCTAACCAGTGTTGGTAATTTACTGAGGATAGTAAAAATGAACTGTTTAAAATAATATTTAAATTTTTATTTATAATACAGAGTCAGTTGTTGTAAATAGTCTGAGTGGTAAATAAGTTCTACCATTAATTAAATATTATCCATATTAAATAAAGGATCT
A 4
>Sequence4_RFP
AGTTTCAGCCAGTGACAGGGTGAGCTGCCAGGTATTCTAACAAGATGAGTTGTTCCAAGAATGTGATCAAGGAGTTCATGAGGTTCAAGGTTCGTATGGAAGGAACGGTCAATGGGCACGAGTTTGAAATAAAAGGCGAAGGTGAAGGGAGGCCTTACGAAGGTCACTGTTCCGTAAAGCTTATGGTAACCAAGGGTGGACCTTTGCCATTTGCTTTTGATATTTTGTCACCACAATTTCAGTATGGAAGCAAGGTATATGTCAAACACCCTGCCGACATACCAGACTATAAAAAGCTGTCATTTCCTGAGGGATTTAAATGGGAAAGGGTCATGAACTTTGAAGACGGTGGCGTGGTTACTGTATCCCAAGATTCCAGTTTGAAAGACGGCTGTTTCATCTACGAGGTCAAGTTCATTGGGGTGAACTTTCCTTCTGATGGACCTGTTATGCAGAGGAGGACACGGGGCTGGGAAGCCAGCTCTGAGCGTTTGTATCCTCGTGATGGGGTGCTGAAAGGAGACATCCATATGGCTCTGAGGCTGGAAGGAGGCGGCCATTACCTCGTTGAATTCAAAAGTATTTACATGGTAAAGAAGCCTTCAGTGCAGTTGCCAGGCTACTATTATGTTGACTCCAAACTGGATATGACGAGCCACAACGAAGATTACACAGTCGTTGAGCAGTATGAAAAAACCCAGGGACGCCACCATCCGTTCATTAAGCCTCTGCAGTGAACTCGGCTCAGTCATGGATTAGCGGTAATGGCCACAAAAGGCACGATGATCGTTTTTTAGGAATGCAGCCAAAAATTGAAGGTTATGACAGTAGAAATACAAGCAACAGGCTTTGCTTATTAAACATGTAATTGAAAAC

Γενετικός κώδικας

Ερωτήσεις

  • Πως μια αλληλουχία DNA μεταφράζεται σε αλληλουχία αμινοξέων; Να περιγράψεις τα βήματα που ακολουθούνται. Μπορείς να χρησιμοποιήσεις το γενετικό κώδικα που παρέχεται πιο πάνω στο πεδίο “Γενετικός κώδικας”.
  • Πως μπορείς να βρεις το σωστό “ανοιχτό πλαίσιο ανάγνωσης”;
  • Στο πεδίο “EMBOSS Transeq output” τι νομίζεις ότι συμβολίζει ο αστερίσκος *;

Πλοήγηση δραστηριότητας

Κυνήγι θησαυρού της πράσινης φθορίζουσας πρωτεΐνης – GFP

Share: