ELLS

European Learning Laboratory for the Life Sciences

Our inspiring educational experiences share the scientific discoveries of EMBL with young learners aged 10-19 years and teachers in Europe and beyond.

This article is also available in  English,  Čeština,  Français,  Italiano and  Svenska

Βήμα 2: Σύγκριση των νουκλεοτιδικών αλληλουχιών

ΣΦΑΙΡΙΚΗ ΕΙΚΟΝΑ

Ταυτόχρονη σύγκριση όλων των νουκλεοτιδικών αλληλουχιών μπορεί να πραγματοποιηθεί μέσω της χρήσης του ειδικού λογισμικού που έχει αναπτύξει το Ευρωπαϊκό Ινστιτούτο Βιοπληροφορικής – EMBL-EBI και το οποίο ονομάζεται MUSCLE. (Multiple Sequence Comparison by Log-Expectation). Το λογισμικό MUSCLE παρέχει ευθυγραμμίσειςαλληλουχιών. Αυτές οι ευθυγραμμίσεις μπορούν να χρησιμοποιηθούν τόσο για την οπτικοποίηση όσο και για την ερμηνεία των σχέσεων μεταξύ των αλληλουχιών – και ορισμένες φορές ακόμη και μεταξύ των ειδών οργανισμών στα οποία ανήκουν.

Μετά την ολοκλήρωση αυτής της δραστηριότητας θα έχεις παράξει μια πολλαπλή ευθυγράμμιση αλληλουχιών (σε νουκλεοτιδικό επίπεδο) και θα είσαι σε θέση να εκτιμήσεις ποιες νουκλεοτιδικές αλληλουχίες είναι πιο όμοιες μεταξύ τους. Μπορείς να δεις τις νουκλεοτιδικές αλληλουχίες που εισήγαγες (input) στο πεδίο “Αλληλουχίες”.

Η εργασία σου

  1. Κάνε αντιγραφή όλων των νουκλεοτιδικών αλληλουχιών που βρίσκονται στο πεδίο “Αλληλουχίες” (για παράδειγμα επίλεξέ τες όλες μαζί και στη συνέχεια αντίγραψέ τες με τα πλήκτρα Ctrl. + C).
  2. Κάνε επικόλληση των νουκλεοτιδικών αλληλουχιών στο πεδίο αναζήτησης του λογισμικού MUSCLE (μπορείς να το κάνεις αυτό με τα πλήκτρα Ctrl. + V).
  3. Ακολούθησε τις οδηγίες του λογισμικού “MUSCLE” για να ευθυγραμμίσεις τις αλληλουχίες σου.
  4. Δες το αποτέλεσμα της ευθυγράμμισης και προσπάθησε να απαντήσεις τις ερωτήσεις στο αντίστοιχο πεδίο.

Λογισμικό MUSCLE

  1. Κάνε αντιγραφή όλων των νουκλεοτιδικών αλληλουχιών που βρίσκονται στο πεδίο “Αλληλουχίες” (για παράδειγμα επίλεξέ τες όλες μαζί και στη συνέχεια αντίγραψέ τες με τα πλήκτρα Ctrl. + C).
  2. Κάνε επικόλληση των νουκλεοτιδικών αλληλουχιών στο πεδίο αναζήτησης του λογισμικού MUSCLE (μπορείς να το κάνεις αυτό με τα πλήκτρα Ctrl. + V).
  3. Στο “Βήμα 2” έλεγξε αν το “Output Format” είναι ρυθμισμένο στο“ClustalW”.
  4. Κάνε κλικ στο κουμπί “Submit” και το λογισμικό θα επεξεργαστεί τις αλληλουχίες που εισήγαγες.
  5. Θα δεις τα αποτελέσματα της επεξεργασίας μετά από μερικά δευτερόλεπτα. Προσπάθησε να απαντήσεις τις ερωτήσεις που σχετίζονται με τα αποτελέσματά σου στο αντίστοιχο πεδίο.

Αλληλουχίες 1-4

A 1
>Sequence1_AVGFP
ATGAGTAAAGGAGAAGAACTTTTCACTGGAGTGGTCCCAGTTCTTGTTGAATTAGATGGCGATGTTAATGGGCAAAAATTCTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAATTTTATTTGCACTACTGGGAAGCTACCTGTTCCATGGCCAACACTTGTCACTACTTTCTCTTATGGTGTTCAATGCTTCTCAAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTACAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAAATGGAATACAACTATAACTCACATAATGTATACATCATGGGAGACAAACCAAAGAATGGCATCAAAGTTAACTTCAAAATTAGACACAACATTAAAGATGGAAGCGTTCAATTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCCAAAGATCCCAACGAAAAGAGAGATCACATGATCCTTCTTGAGTTTGTAACAGCTGCTAGGATTACACATGGCATGGATGAACTATACAAA
A 2
 >Sequence2_GFPm
ATGTCTAAAGGTGAAGAATTATTCACTGGTGTTGTCCCAATTTTGGTTGAATTAGATGGTGATGTTAATGGTCACAAATTTTCTGTCTCCGGTGAAGGTGAAGGTGATGCTACTTACGGTAAATTGACCTTAAAATTTATTTGTACTACTGGTAAATTGCCAGTTCCATGGCCAACCTTAGTCACTACTTTCGGTTATGGTGTTCAATGTTTTGCTAGATACCCAGATCATATGAAACAACATGACTTTTTCAAGTCTGCCATGCCAGAAGGTTATGTTCAAGAAAGAACTATTTTTTTCAAAGATGACGGTAACTACAAGACCAGAGCTGAAGTCAAGTTTGAAGGTGATACCTTAGTTAATAGAATCGAATTAAAAGGTATTGATTTTAAAGAAGATGGTAACATTTTAGGTCACAAATTGGAATACAACTATAACTCTCACAATGTTTACATCATGGCTGACAAACAAAAGAATGGTATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGTTCTGTTCAATTAGCTGACCATTATCAACAAAATACTCCAATTGGTGATGGTCCAGTCTTGTTACCAGACAACCATTACTTATCCACTCAATCTGCCTTATCCAAAGATCCAAACGAAAAGAGAGACCACATGGTCTTGTTAGAATTTGTTACTGCTGCTGGTATTACCCATGGTATGGATGAATTGTACAAATAACTGCAG
A 3
>Sequence3_YFP
AATATTTTTATTAATTCATTAGAAAAATGAGAGGAAGGATTATTATGTTTAAAGGTATAGTAGAAGGTATAGGAATCATTGAAAAAATTGATATATATACTGACCTAGATAAGTATGCAATTCGATTTCCTGAAAATATGTTGAATGGAATTAAAAAGGAGTCGTCAATAATGTTTAACGGATGCTTCTTAACGGTAACTAGCGTGAATTCAAACATTGTCTGGTTTGATATATTTGAAAAAGAAGCACGTAAGCTTGATACTTTTCGGGAATATAAGGTAGGTGACCGAGTAAATTTAGGAACATTCCCAAAATTTGGCGCTGCATCTGGTGGGCATATATTATCAGCAAGGATTTCATGTGTAGCAAGTATTATTGAAATAATAGAAAATGAGGATTATCAACAAATGTGGATTCAAATTCCTGAAAATTTTACAGAGTTTCTTATTGATAAAGACTATATTGCTGTGGATGGTATTAGCTTAACTATTGACACTATAAAAAACAACCAATTTTTCATTAGTTTACCCTTAAAAATAGCACAAAATACAAATATGAAATGGCGAAAAAAAGGTGATAAGGTAAATGTTGAGTTATCAAACAAAATTAATGCTAACCAGTGTTGGTAATTTACTGAGGATAGTAAAAATGAACTGTTTAAAATAATATTTAAATTTTTATTTATAATACAGAGTCAGTTGTTGTAAATAGTCTGAGTGGTAAATAAGTTCTACCATTAATTAAATATTATCCATATTAAATAAAGGATCT
A 4
>Sequence4_RFP
AGTTTCAGCCAGTGACAGGGTGAGCTGCCAGGTATTCTAACAAGATGAGTTGTTCCAAGAATGTGATCAAGGAGTTCATGAGGTTCAAGGTTCGTATGGAAGGAACGGTCAATGGGCACGAGTTTGAAATAAAAGGCGAAGGTGAAGGGAGGCCTTACGAAGGTCACTGTTCCGTAAAGCTTATGGTAACCAAGGGTGGACCTTTGCCATTTGCTTTTGATATTTTGTCACCACAATTTCAGTATGGAAGCAAGGTATATGTCAAACACCCTGCCGACATACCAGACTATAAAAAGCTGTCATTTCCTGAGGGATTTAAATGGGAAAGGGTCATGAACTTTGAAGACGGTGGCGTGGTTACTGTATCCCAAGATTCCAGTTTGAAAGACGGCTGTTTCATCTACGAGGTCAAGTTCATTGGGGTGAACTTTCCTTCTGATGGACCTGTTATGCAGAGGAGGACACGGGGCTGGGAAGCCAGCTCTGAGCGTTTGTATCCTCGTGATGGGGTGCTGAAAGGAGACATCCATATGGCTCTGAGGCTGGAAGGAGGCGGCCATTACCTCGTTGAATTCAAAAGTATTTACATGGTAAAGAAGCCTTCAGTGCAGTTGCCAGGCTACTATTATGTTGACTCCAAACTGGATATGACGAGCCACAACGAAGATTACACAGTCGTTGAGCAGTATGAAAAAACCCAGGGACGCCACCATCCGTTCATTAAGCCTCTGCAGTGAACTCGGCTCAGTCATGGATTAGCGGTAATGGCCACAAAAGGCACGATGATCGTTTTTTAGGAATGCAGCCAAAAATTGAAGGTTATGACAGTAGAAATACAAGCAACAGGCTTTGCTTATTAAACATGTAATTGAAAAC

Ερωτήσεις

Δες την ευθυγράμμιση των αλληλουχιών σου και προσπάθησε να απαντήσεις στις επόμενες ερωτήσεις:

  • Πως μπορείς να γνωρίζεις αν τα νουκλεοτίδια κάθε αλληλουχίας είναι τα ίδια ή όχι με αυτά των υπολοίπων αλληλουχιών;
  • Πιστεύεις ότι υπάρχει μεγάλος αριθμός όμοιων νουκλεοτιδίων μεταξύ των αλληλουχιών; Το περίμενες αυτό; Εξήγησε.
  • Ποιες δύο αλληλουχίες κρίνεις ότι είναι περισσότερο όμοιες μεταξύ τους;Γιατί;

Πλοήγηση δραστηριότητας

Κυνήγι θησαυρού της πράσινης φθορίζουσας πρωτεΐνης – GFP

Share: