ELLS

European Learning Laboratory for the Life Sciences

Our inspiring educational experiences share the scientific discoveries of EMBL with young learners aged 10-19 years and teachers in Europe and beyond.

This article is also available in  English,  Čeština,  Français,  Italiano and  Svenska

Βήμα 1: Αναζήτηση στη βάση δεδομένων “ΕΝΑ”

ΣΦΑΙΡΙΚΗ ΕΙΚΟΝΑ

Φαντάσου ότι τα δείγματα DNA μπερδεύτηκαν πριν την αλληλούχησή τους και δε μπορούμε να τα ταυτοποιήσουμε. Για να μπορέσουμε να βρούμε την ταυτότητα των αλληλουχιών και να συλλέξουμε πληροφορίες για την προέλευσή τους θα κάνουμε αναζήτηση σε μια βάση δεδομένων που ονομάζεται European Nucleotide Archive (ENA).
Οι αλληλουχίες που θα χρησιμοποιήσουμε για την ανάλυσή μας μπορούν να βρεθούν στο πεδίο “Α” που βρίσκεται πιο κάτω. Κάθε μια έχει κάποιο κωδικό όνομα, αφού πραγματοποιήσεις την αναζήτηση στη βάση δεδομένων ΕΝΑ θα μπορείς να αντιστοιχίσεις κάθε μια από τις τέσσερις αλληλουχίες με τον οργανισμό από τον οποίο προέρχεται.

Η εργασία σου

Προχώρησε όπως περιγράφεται παρακάτω:

  1. Πήγαινε στο πεδίο “Sequence 1” και κάνε αντιγραφή ολόκληρης της αλληλουχίας που ξεκινά με το όνομα “>Sequence 1”. Μπορείς να χρησιμοποιήσεις επίσης το συνδυασμό πλήκτρων Ctrl.+C για να αντιγράψεις την αλληλουχία.
  2. Ακολούθησε τις οδηγίες στο πεδίο “ENA” για να κάνεις αναζήτηση στη βάση δεδομένων.
  3. Κράτησε σημειώσεις από τα αποτελέσματά σου και προσπάθησε να απαντήσεις τις ερωτήσεις στο αντίστοιχο πεδίο. Στη συνέχεια επανάλαβε αυτήν τη διαδικασία για τις υπόλοιπες αλληλουχίες.

Βάση δεδομένων ENA

  1. Επικόλλησε την αλληλουχία στο πεδίο αναζήτησης της βάσης δεδομένων ENA (shortcut Ctrl.+V).
  2. Στη συνέχεια, κάνε κλικ στο “Submit που βρίσκεται στο τέλος της σελίδας και η αναζήτησή σου θα ξεκινήσει. Η αλληλουχία που έχεις εισάγει θα συγκριθεί με όλες τις γνωστές αλληλουχίες που περιέχονται στη βάση δεδομένων.
  3. Τα αποτελέσματα της αναζήτησης θα εμφανιστούν μετά από λίγα δευτερόλεπτα. Πλοηγήσου στη σελίδα των αποτελεσμάτων μέχρι να εντοπίσεις τις στήλες με τον τίτλο “ENA” και προσπάθησε να βρεις σε ποιο είδος οργανισμού αντιστοιχίστηκε η αλληλουχία που εισήγαγες. Οι περισσότερο όμοιες αλληλουχίες εμφανίζουν ομοιότητα “Identity (%)” της τάξης του 100 και τιμή “E-Value” ίση με 0.
  4. Κράτησε σημειώσεις από τα αποτελέσματά σου και προσπάθησε να απαντήσεις τις ερωτήσεις στο αντίστοιχο πεδίο. Στη συνέχεια επανάλαβε αυτήν τη διαδικασία για τις υπόλοιπες αλληλουχίες.

Ακολουθίες A1-A4

A 1
>Sequence1_AVGFP
ATGAGTAAAGGAGAAGAACTTTTCACTGGAGTGGTCCCAGTTCTTGTTGAATTAGATGGCGATGTTAATGGGCAAAAATTCTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAATTTTATTTGCACTACTGGGAAGCTACCTGTTCCATGGCCAACACTTGTCACTACTTTCTCTTATGGTGTTCAATGCTTCTCAAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTACAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAAATGGAATACAACTATAACTCACATAATGTATACATCATGGGAGACAAACCAAAGAATGGCATCAAAGTTAACTTCAAAATTAGACACAACATTAAAGATGGAAGCGTTCAATTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCCAAAGATCCCAACGAAAAGAGAGATCACATGATCCTTCTTGAGTTTGTAACAGCTGCTAGGATTACACATGGCATGGATGAACTATACAAA
A 2

>Sequence2_GFPm
ATGTCTAAAGGTGAAGAATTATTCACTGGTGTTGTCCCAATTTTGGTTGAATTAGATGGTGATGTTAATGGTCACAAATTTTCTGTCTCCGGTGAAGGTGAAGGTGATGCTACTTACGGTAAATTGACCTTAAAATTTATTTGTACTACTGGTAAATTGCCAGTTCCATGGCCAACCTTAGTCACTACTTTCGGTTATGGTGTTCAATGTTTTGCTAGATACCCAGATCATATGAAACAACATGACTTTTTCAAGTCTGCCATGCCAGAAGGTTATGTTCAAGAAAGAACTATTTTTTTCAAAGATGACGGTAACTACAAGACCAGAGCTGAAGTCAAGTTTGAAGGTGATACCTTAGTTAATAGAATCGAATTAAAAGGTATTGATTTTAAAGAAGATGGTAACATTTTAGGTCACAAATTGGAATACAACTATAACTCTCACAATGTTTACATCATGGCTGACAAACAAAAGAATGGTATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGTTCTGTTCAATTAGCTGACCATTATCAACAAAATACTCCAATTGGTGATGGTCCAGTCTTGTTACCAGACAACCATTACTTATCCACTCAATCTGCCTTATCCAAAGATCCAAACGAAAAGAGAGACCACATGGTCTTGTTAGAATTTGTTACTGCTGCTGGTATTACCCATGGTATGGATGAATTGTACAAATAACTGCAG
A 3
>Sequence3_YFP
AATATTTTTATTAATTCATTAGAAAAATGAGAGGAAGGATTATTATGTTTAAAGGTATAGTAGAAGGTATAGGAATCATTGAAAAAATTGATATATATACTGACCTAGATAAGTATGCAATTCGATTTCCTGAAAATATGTTGAATGGAATTAAAAAGGAGTCGTCAATAATGTTTAACGGATGCTTCTTAACGGTAACTAGCGTGAATTCAAACATTGTCTGGTTTGATATATTTGAAAAAGAAGCACGTAAGCTTGATACTTTTCGGGAATATAAGGTAGGTGACCGAGTAAATTTAGGAACATTCCCAAAATTTGGCGCTGCATCTGGTGGGCATATATTATCAGCAAGGATTTCATGTGTAGCAAGTATTATTGAAATAATAGAAAATGAGGATTATCAACAAATGTGGATTCAAATTCCTGAAAATTTTACAGAGTTTCTTATTGATAAAGACTATATTGCTGTGGATGGTATTAGCTTAACTATTGACACTATAAAAAACAACCAATTTTTCATTAGTTTACCCTTAAAAATAGCACAAAATACAAATATGAAATGGCGAAAAAAAGGTGATAAGGTAAATGTTGAGTTATCAAACAAAATTAATGCTAACCAGTGTTGGTAATTTACTGAGGATAGTAAAAATGAACTGTTTAAAATAATATTTAAATTTTTATTTATAATACAGAGTCAGTTGTTGTAAATAGTCTGAGTGGTAAATAAGTTCTACCATTAATTAAATATTATCCATATTAAATAAAGGATCT
A 4
>Sequence4_RFP
AGTTTCAGCCAGTGACAGGGTGAGCTGCCAGGTATTCTAACAAGATGAGTTGTTCCAAGAATGTGATCAAGGAGTTCATGAGGTTCAAGGTTCGTATGGAAGGAACGGTCAATGGGCACGAGTTTGAAATAAAAGGCGAAGGTGAAGGGAGGCCTTACGAAGGTCACTGTTCCGTAAAGCTTATGGTAACCAAGGGTGGACCTTTGCCATTTGCTTTTGATATTTTGTCACCACAATTTCAGTATGGAAGCAAGGTATATGTCAAACACCCTGCCGACATACCAGACTATAAAAAGCTGTCATTTCCTGAGGGATTTAAATGGGAAAGGGTCATGAACTTTGAAGACGGTGGCGTGGTTACTGTATCCCAAGATTCCAGTTTGAAAGACGGCTGTTTCATCTACGAGGTCAAGTTCATTGGGGTGAACTTTCCTTCTGATGGACCTGTTATGCAGAGGAGGACACGGGGCTGGGAAGCCAGCTCTGAGCGTTTGTATCCTCGTGATGGGGTGCTGAAAGGAGACATCCATATGGCTCTGAGGCTGGAAGGAGGCGGCCATTACCTCGTTGAATTCAAAAGTATTTACATGGTAAAGAAGCCTTCAGTGCAGTTGCCAGGCTACTATTATGTTGACTCCAAACTGGATATGACGAGCCACAACGAAGATTACACAGTCGTTGAGCAGTATGAAAAAACCCAGGGACGCCACCATCCGTTCATTAAGCCTCTGCAGTGAACTCGGCTCAGTCATGGATTAGCGGTAATGGCCACAAAAGGCACGATGATCGTTTTTTAGGAATGCAGCCAAAAATTGAAGGTTATGACAGTAGAAATACAAGCAACAGGCTTTGCTTATTAAACATGTAATTGAAAAC

Ερωτήσεις

  • Σε ποιο είδος οργανισμού μπορεί να αντιστοιχιστεί κάθε μια από τις αλληλουχίες 1, 2, 3 και 4;
  • Στο πεδίο Ευθυγραμμίσεις ή “Alignments” οι αλληλουχίες που εισήγαγες συγκρίνονται ανά δύο μεταξύ τους όσον αφορά στα νουκλεοτίδια που περιέχουν. Η διαδικασία αυτή ονομάζεται “ευθυγράμμιση κατά ζεύγη” ή “pairwise alignment”. Για να δεις την ευθυγράμμιση των αλληλουχιών κάνε κλικ στο πεδίο περιγραφής κάθε μιας αλληλουχίας ή κάνε κλικ στο πεδίο “Show all alignments” στο τέλος της σελίδας των αποτελεσμάτων της βάσης δεδομένων ENA.
    • Πως απεικονίζονται τα νουκλεοτίδια που ταιριάζουν στις δύο αλληλουχίες;
    • Σύγκρινε την αλληλουχία που εισήγαγες με την αλληλουχία της βάσης δεδομένων. Υπάρχουν διαφορές μεταξύ της αλληλουχίας σου (query) και αυτής που είναι αποθηκευμένη στη βάση δεδομένων (subject);
    • Υπάρχουν διαφορές μεταξύ των νουκλεοτιδίων των δύο αλληλουχιών; Αν ναι, σε ποιους λόγους μπορεί να οφείλεται αυτό;

Πλοήγηση δραστηριότητας

Κυνήγι θησαυρού της πράσινης φθορίζουσας πρωτεΐνης – GFP

Share: