Edit

ELLS

European Learning Laboratory for the Life Sciences

Our inspiring educational experiences share the scientific discoveries of EMBL with young learners aged 10-19 years and teachers in Europe and beyond.

This article is also available in  Čeština,  Français,  Ελληνικά,  Italiano and  Svenska

Step 2: Comparison of nucleotide sequences

Overview

A simultaneous comparison of all your nucleotide sequences can be achieved by using the server-based software EMBL-EBI MUSCLE (Multiple Sequence Comparison by Log-Expectation). MUSCLE produces so-called sequence alignments. These alignments can be used to visualise and interpret the relationships between sequences – and sometimes even between species.

After completing this exercise you should have produced a multiple sequence alignment (on nucleotide level) and will be able to assess roughly which nucleotide sequences are most similar to each other. The nucleotide sequences (input) are provided in the tab “Sequences”.

Your task

Proceed as described below:

  1. Copy all of the nucleotide sequences which are provided under the tab “Sequences” at once (i.e. select and copy the whole block of sequences) (shortcut Ctrl. + C).
  2. Paste the nucleotide sequences into the MUSCLE search box (shortcut Ctrl. + V).
  3. Follow the instructions in the tab “MUSCLE” to align your sequences.
  4. Have a look at the alignment and try to answer the questions in the “Questions” tab.

MUSCLE

  1. Copy all of the nucleotide sequences which are provided under the tab “Sequences” at once (i.e. select and copy the whole block of sequences) (shortcut Ctrl. + C).
  2. Paste the nucleotide sequences into the MUSCLE search box (shortcut Ctrl. + V).
  3. In the “STEP 2” section ensure that “Output Format” is set at “ClustalW”.
  4. Just click on the large “Submit” button and your alignment will be processed.
  5. You will see the results after a few seconds. Have a look at the alignment and try to answer the questions in the “Questions” tab.

Sequences 1-4

Sequence 1
>Sequence1_AVGFP
ATGAGTAAAGGAGAAGAACTTTTCACTGGAGTGGTCCCAGTTCTTGTTGAATTAGATGGCGATGTTAATGGGCAAAAATTCTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAATTTTATTTGCACTACTGGGAAGCTACCTGTTCCATGGCCAACACTTGTCACTACTTTCTCTTATGGTGTTCAATGCTTCTCAAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTACAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAAATGGAATACAACTATAACTCACATAATGTATACATCATGGGAGACAAACCAAAGAATGGCATCAAAGTTAACTTCAAAATTAGACACAACATTAAAGATGGAAGCGTTCAATTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCCAAAGATCCCAACGAAAAGAGAGATCACATGATCCTTCTTGAGTTTGTAACAGCTGCTAGGATTACACATGGCATGGATGAACTATACAAA
Sequence 2
 >Sequence2_GFPm
ATGTCTAAAGGTGAAGAATTATTCACTGGTGTTGTCCCAATTTTGGTTGAATTAGATGGTGATGTTAATGGTCACAAATTTTCTGTCTCCGGTGAAGGTGAAGGTGATGCTACTTACGGTAAATTGACCTTAAAATTTATTTGTACTACTGGTAAATTGCCAGTTCCATGGCCAACCTTAGTCACTACTTTCGGTTATGGTGTTCAATGTTTTGCTAGATACCCAGATCATATGAAACAACATGACTTTTTCAAGTCTGCCATGCCAGAAGGTTATGTTCAAGAAAGAACTATTTTTTTCAAAGATGACGGTAACTACAAGACCAGAGCTGAAGTCAAGTTTGAAGGTGATACCTTAGTTAATAGAATCGAATTAAAAGGTATTGATTTTAAAGAAGATGGTAACATTTTAGGTCACAAATTGGAATACAACTATAACTCTCACAATGTTTACATCATGGCTGACAAACAAAAGAATGGTATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGTTCTGTTCAATTAGCTGACCATTATCAACAAAATACTCCAATTGGTGATGGTCCAGTCTTGTTACCAGACAACCATTACTTATCCACTCAATCTGCCTTATCCAAAGATCCAAACGAAAAGAGAGACCACATGGTCTTGTTAGAATTTGTTACTGCTGCTGGTATTACCCATGGTATGGATGAATTGTACAAATAACTGCAG
Sequence 3
>Sequence3_YFP
AATATTTTTATTAATTCATTAGAAAAATGAGAGGAAGGATTATTATGTTTAAAGGTATAGTAGAAGGTATAGGAATCATTGAAAAAATTGATATATATACTGACCTAGATAAGTATGCAATTCGATTTCCTGAAAATATGTTGAATGGAATTAAAAAGGAGTCGTCAATAATGTTTAACGGATGCTTCTTAACGGTAACTAGCGTGAATTCAAACATTGTCTGGTTTGATATATTTGAAAAAGAAGCACGTAAGCTTGATACTTTTCGGGAATATAAGGTAGGTGACCGAGTAAATTTAGGAACATTCCCAAAATTTGGCGCTGCATCTGGTGGGCATATATTATCAGCAAGGATTTCATGTGTAGCAAGTATTATTGAAATAATAGAAAATGAGGATTATCAACAAATGTGGATTCAAATTCCTGAAAATTTTACAGAGTTTCTTATTGATAAAGACTATATTGCTGTGGATGGTATTAGCTTAACTATTGACACTATAAAAAACAACCAATTTTTCATTAGTTTACCCTTAAAAATAGCACAAAATACAAATATGAAATGGCGAAAAAAAGGTGATAAGGTAAATGTTGAGTTATCAAACAAAATTAATGCTAACCAGTGTTGGTAATTTACTGAGGATAGTAAAAATGAACTGTTTAAAATAATATTTAAATTTTTATTTATAATACAGAGTCAGTTGTTGTAAATAGTCTGAGTGGTAAATAAGTTCTACCATTAATTAAATATTATCCATATTAAATAAAGGATCT
Sequence 4
>Sequence4_RFP
AGTTTCAGCCAGTGACAGGGTGAGCTGCCAGGTATTCTAACAAGATGAGTTGTTCCAAGAATGTGATCAAGGAGTTCATGAGGTTCAAGGTTCGTATGGAAGGAACGGTCAATGGGCACGAGTTTGAAATAAAAGGCGAAGGTGAAGGGAGGCCTTACGAAGGTCACTGTTCCGTAAAGCTTATGGTAACCAAGGGTGGACCTTTGCCATTTGCTTTTGATATTTTGTCACCACAATTTCAGTATGGAAGCAAGGTATATGTCAAACACCCTGCCGACATACCAGACTATAAAAAGCTGTCATTTCCTGAGGGATTTAAATGGGAAAGGGTCATGAACTTTGAAGACGGTGGCGTGGTTACTGTATCCCAAGATTCCAGTTTGAAAGACGGCTGTTTCATCTACGAGGTCAAGTTCATTGGGGTGAACTTTCCTTCTGATGGACCTGTTATGCAGAGGAGGACACGGGGCTGGGAAGCCAGCTCTGAGCGTTTGTATCCTCGTGATGGGGTGCTGAAAGGAGACATCCATATGGCTCTGAGGCTGGAAGGAGGCGGCCATTACCTCGTTGAATTCAAAAGTATTTACATGGTAAAGAAGCCTTCAGTGCAGTTGCCAGGCTACTATTATGTTGACTCCAAACTGGATATGACGAGCCACAACGAAGATTACACAGTCGTTGAGCAGTATGAAAAAACCCAGGGACGCCACCATCCGTTCATTAAGCCTCTGCAGTGAACTCGGCTCAGTCATGGATTAGCGGTAATGGCCACAAAAGGCACGATGATCGTTTTTTAGGAATGCAGCCAAAAATTGAAGGTTATGACAGTAGAAATACAAGCAACAGGCTTTGCTTATTAAACATGTAATTGAAAAC

Questions

Have a look at the alignment and try to answer the following questions:

  • How do you know whether the nucleotides in the individual sequences are the same or not compared to the other aligned sequences?
  • Do you think there many corresponding nucleotides? Would you have expected something else?
  • Which of the two sequences would you judge as being most similar?

Activity navigation

GFP treasure hunt

Share:

Edit