ELLS

European Learning Laboratory for the Life Sciences

Our inspiring educational experiences share the scientific discoveries of EMBL with young learners aged 10-19 years and teachers in Europe and beyond.

This article is also available in  English,  Čeština,  Ελληνικά,  Italiano and  Svenska

Étape 1: Recherche avec bases de données

Aperçu

Imaginez que vos échantillons d’ADN aient été mélangés avant d’être séquencés et que nous n’avions aucun moyen de les reconnaître. Pour établir l’identité des séquences et en savoir plus sur leurs origines, nous effectuerons une recherche dans une base de données qui s’appelle l’European nucleotide archive ou l’ENA (Registre Européen des nucléotides).

Les séquences que nous utiliserons pour les besoins de nos analyses sont disponibles sous les onglets “Séquences” ci-dessous. Chacune d’elles possède un nom générique, et suite à votre recherche dans l’ENA, vous devriez être en mesure d’assigner les séquences à quatre organismes d’origine.

Tâche

Suivez la procédure suivante :

  1. Allez à l’onglet “Séquence 1″ et copiez la séquence entière débutant par >”Séquence 1”. Vous pouvez utiliser le raccourci clavier Ctrl.+C pour copier la séquence.
  2. Suivez les instructions sous l’onglet “ENA” pour effectuer une recherche dans la base de données.
  3. Prenez en note ce que vous avez trouvé, essayez de répondre aux questions sous l’onglet “Questions” et répétez cette procédure avec le reste des séquences.

ENA

  1. Collez la séquence dans la zone de recherche ENA (raccourci clavier : Ctrl.+V).
  2. Maintenant, cliquez en bas sur “Envoyer” et pour démarrer votre recherche. La séquence insérée pourra alors être comparée à toutes les séquences connues disponibles dans la base de données.
  3. Les résultats de la recherche vous seront présentés en quelques secondes. Faites défiler la page jusqu’aux colonnes identifiées “ENA” et essayez de trouver quelles espèces correspondent à votre séquence. Les séquences les plus apparentées on une valeur d'”Identité (%)” de 100 et une “E-Value” (valeur attendue) de 0.
  4. Veuillez prendre en note ce que vous avez trouvé, essayez de répondre aux questions sous l’onglet “Questions” et répétez cette procédure avec le reste des séquences.

Séquence 1-4

Séquence 1
>Sequence1_AVGFP
ATGAGTAAAGGAGAAGAACTTTTCACTGGAGTGGTCCCAGTTCTTGTTGAATTAGATGGCGATGTTAATGGGCAAAAATTCTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAATTTTATTTGCACTACTGGGAAGCTACCTGTTCCATGGCCAACACTTGTCACTACTTTCTCTTATGGTGTTCAATGCTTCTCAAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTACAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAAATGGAATACAACTATAACTCACATAATGTATACATCATGGGAGACAAACCAAAGAATGGCATCAAAGTTAACTTCAAAATTAGACACAACATTAAAGATGGAAGCGTTCAATTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCCAAAGATCCCAACGAAAAGAGAGATCACATGATCCTTCTTGAGTTTGTAACAGCTGCTAGGATTACACATGGCATGGATGAACTATACAAA
Séquence 2

>Sequence2_GFPm
ATGTCTAAAGGTGAAGAATTATTCACTGGTGTTGTCCCAATTTTGGTTGAATTAGATGGTGATGTTAATGGTCACAAATTTTCTGTCTCCGGTGAAGGTGAAGGTGATGCTACTTACGGTAAATTGACCTTAAAATTTATTTGTACTACTGGTAAATTGCCAGTTCCATGGCCAACCTTAGTCACTACTTTCGGTTATGGTGTTCAATGTTTTGCTAGATACCCAGATCATATGAAACAACATGACTTTTTCAAGTCTGCCATGCCAGAAGGTTATGTTCAAGAAAGAACTATTTTTTTCAAAGATGACGGTAACTACAAGACCAGAGCTGAAGTCAAGTTTGAAGGTGATACCTTAGTTAATAGAATCGAATTAAAAGGTATTGATTTTAAAGAAGATGGTAACATTTTAGGTCACAAATTGGAATACAACTATAACTCTCACAATGTTTACATCATGGCTGACAAACAAAAGAATGGTATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGTTCTGTTCAATTAGCTGACCATTATCAACAAAATACTCCAATTGGTGATGGTCCAGTCTTGTTACCAGACAACCATTACTTATCCACTCAATCTGCCTTATCCAAAGATCCAAACGAAAAGAGAGACCACATGGTCTTGTTAGAATTTGTTACTGCTGCTGGTATTACCCATGGTATGGATGAATTGTACAAATAACTGCAG
Séquence 3
>Sequence3_YFP
AATATTTTTATTAATTCATTAGAAAAATGAGAGGAAGGATTATTATGTTTAAAGGTATAGTAGAAGGTATAGGAATCATTGAAAAAATTGATATATATACTGACCTAGATAAGTATGCAATTCGATTTCCTGAAAATATGTTGAATGGAATTAAAAAGGAGTCGTCAATAATGTTTAACGGATGCTTCTTAACGGTAACTAGCGTGAATTCAAACATTGTCTGGTTTGATATATTTGAAAAAGAAGCACGTAAGCTTGATACTTTTCGGGAATATAAGGTAGGTGACCGAGTAAATTTAGGAACATTCCCAAAATTTGGCGCTGCATCTGGTGGGCATATATTATCAGCAAGGATTTCATGTGTAGCAAGTATTATTGAAATAATAGAAAATGAGGATTATCAACAAATGTGGATTCAAATTCCTGAAAATTTTACAGAGTTTCTTATTGATAAAGACTATATTGCTGTGGATGGTATTAGCTTAACTATTGACACTATAAAAAACAACCAATTTTTCATTAGTTTACCCTTAAAAATAGCACAAAATACAAATATGAAATGGCGAAAAAAAGGTGATAAGGTAAATGTTGAGTTATCAAACAAAATTAATGCTAACCAGTGTTGGTAATTTACTGAGGATAGTAAAAATGAACTGTTTAAAATAATATTTAAATTTTTATTTATAATACAGAGTCAGTTGTTGTAAATAGTCTGAGTGGTAAATAAGTTCTACCATTAATTAAATATTATCCATATTAAATAAAGGATCT
Séquence 4
>Sequence4_RFP
AGTTTCAGCCAGTGACAGGGTGAGCTGCCAGGTATTCTAACAAGATGAGTTGTTCCAAGAATGTGATCAAGGAGTTCATGAGGTTCAAGGTTCGTATGGAAGGAACGGTCAATGGGCACGAGTTTGAAATAAAAGGCGAAGGTGAAGGGAGGCCTTACGAAGGTCACTGTTCCGTAAAGCTTATGGTAACCAAGGGTGGACCTTTGCCATTTGCTTTTGATATTTTGTCACCACAATTTCAGTATGGAAGCAAGGTATATGTCAAACACCCTGCCGACATACCAGACTATAAAAAGCTGTCATTTCCTGAGGGATTTAAATGGGAAAGGGTCATGAACTTTGAAGACGGTGGCGTGGTTACTGTATCCCAAGATTCCAGTTTGAAAGACGGCTGTTTCATCTACGAGGTCAAGTTCATTGGGGTGAACTTTCCTTCTGATGGACCTGTTATGCAGAGGAGGACACGGGGCTGGGAAGCCAGCTCTGAGCGTTTGTATCCTCGTGATGGGGTGCTGAAAGGAGACATCCATATGGCTCTGAGGCTGGAAGGAGGCGGCCATTACCTCGTTGAATTCAAAAGTATTTACATGGTAAAGAAGCCTTCAGTGCAGTTGCCAGGCTACTATTATGTTGACTCCAAACTGGATATGACGAGCCACAACGAAGATTACACAGTCGTTGAGCAGTATGAAAAAACCCAGGGACGCCACCATCCGTTCATTAAGCCTCTGCAGTGAACTCGGCTCAGTCATGGATTAGCGGTAATGGCCACAAAAGGCACGATGATCGTTTTTTAGGAATGCAGCCAAAAATTGAAGGTTATGACAGTAGAAATACAAGCAACAGGCTTTGCTTATTAAACATGTAATTGAAAAC

Questions

  • Quelles espèces correspondent aux séquences 1, 2, 3 et 4 ?
  • En observant les “Alignements”,voustrouverezunecomparaison 1 à 1 des deuxséquences.Cette techniques’appelle “alignement parpaires”. Pourvisualiserl’alignement,vouspouvezcliquer sur la description desrésultats de larechercheindividuelle ou sur “Affichertous lesalignements” au bas desrésultatsENA.
    • Comment sont représentés les nucléotides qui correspondent aux deux séquences ?
    • Comparez la séquence que vous avez entré avec la séquence de la base de données. Y a-t-il des différences entre votre séquence (demande) et la séquence enregistrée dans la base de données (sujet) ?
    • Y a-t-il des différences entre les nucléotides individuels des deux séquences ? Veuillez justifier votre réponse.

Navigation d’activité

Chasse au trésor GFP

Share: